Skip to main content

pSIN-Arkadia-gRNA6
(Plasmid #180367)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180367 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSIN
  • Backbone size w/o insert (bp) 7099
  • Total vector size (bp) 7058
  • Modifications to backbone
    The retroviral sgRNA expression vector pSIN-U6-sgRNA-EF1as-Thy1.1-P2A-Neo was generated by mutating a pSIN vector backbone and the 5′ LTR to remove BbsI sites and assembling a hU6-BbsI-filler-BbsI-tracr EF1as-Thy1.1-P2A-Neo cassette downstream from the packaging signal
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable ; Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Arkadia targeting gRNA
  • Alt name
    RNF111
  • gRNA/shRNA sequence
    GGAAAAGGTGCATACATGGA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Rnf111 (a.k.a. ARK, Arkadia)
  • Promoter human U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer LKO.1-5'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIN-Arkadia-gRNA6 was a gift from Dan Littman (Addgene plasmid # 180367 ; http://n2t.net/addgene:180367 ; RRID:Addgene_180367)
  • For your References section:

    Arkadia-SKI/SnoN signaling differentially regulates TGF-beta-induced iTreg and Th17 cell differentiation. Xu H, Wu L, Nguyen HH, Mesa KR, Raghavan V, Episkopou V, Littman DR. J Exp Med. 2021 Nov 1;218(11). pii: 212614. doi: 10.1084/jem.20210777. Epub 2021 Sep 2. 10.1084/jem.20210777 PubMed 34473197