pSIN-Ski-gRNA2
(Plasmid #180369)

• Purpose: targeting mouse Ski gene
• Depositing Lab: Dan Littman
• Publication: Xu et al J Exp Med. 2021 Nov 1;218(11). pii: 212614. doi: 10.1084/jem.20210777. Epub 2021 Sep 2.

Backbone

• Vector backbone: pSIN
• Backbone size w/o insert (bp): 7099
• Total vector size (bp): 7058
• Modifications to backbone: The retroviral sgRNA expression vector pSIN-U6-sgRNA-EF1as-Thy1.1-P2A-Neo was generated by mutating a pSIN vector backbone and the 5′ LTR to remove BbsI sites and assembling a hU6-BbsI-filler-BbsI-tracr EF1as-Thy1.1-P2A-Neo cassette downstream from the packaging signal
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable ; Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ski targeting gRNA
• gRNA/shRNA sequence: GGTACATGAGGCGGCAGTCG
• Species: M. musculus (mouse)
• Entrez Gene: Ski (a.k.a. 2310012I02Rik, 2610001A11Rik, AA062172, AA589460, BC004088)
• Promoter: human U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: LKO.1-5'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry