MSCV-Arkadia
              
              
                (Plasmid
                
                #180372)
              
            
            
            
          - 
            Purposeexpressing mouse Arkadia proteins
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180372 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneMSCV-IRES-Thy1.1 DEST
- Backbone size w/o insert (bp) 6395
- 
              Vector typeMammalian Expression, Retroviral
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable ; Stbl3
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameArkadia
- 
                  Alt nameRNF111
- 
                    SpeciesM. musculus (mouse)
- 
                        Entrez GeneRnf111 (a.k.a. ARK, Arkadia)
- Promoter LTR promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI sticky end to 5' of Arkadia and BglII sticky end of MSCV (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CGTCTCTCCCCCTTGAACCT
- 3′ sequencing primer GGGGCGGAATTCGATATCAAGCT (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: MSCV-Arkadia was a gift from Dan Littman (Addgene plasmid # 180372 ; http://n2t.net/addgene:180372 ; RRID:Addgene_180372)
- 
                For your References section: Arkadia-SKI/SnoN signaling differentially regulates TGF-beta-induced iTreg and Th17 cell differentiation. Xu H, Wu L, Nguyen HH, Mesa KR, Raghavan V, Episkopou V, Littman DR. J Exp Med. 2021 Nov 1;218(11). pii: 212614. doi: 10.1084/jem.20210777. Epub 2021 Sep 2. 10.1084/jem.20210777 PubMed 34473197
