Skip to main content
Addgene

W118-1_hSTK16-Flag
(Plasmid #180403)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180403 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    W118-1
  • Backbone size w/o insert (bp) 8015
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    STK16
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    948
  • Entrez Gene
    STK16 (a.k.a. KRCT, MPSK, PKL12, PSK, TSF1, hPSK)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CMV forward
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    W118-1_hSTK16-Flag was a gift from Huda Zoghbi (Addgene plasmid # 180403 ; http://n2t.net/addgene:180403 ; RRID:Addgene_180403)
  • For your References section:

    Cross-species genetic screens identify transglutaminase 5 as a regulator of polyglutamine-expanded ataxin-1. Lee WS, Al-Ramahi I, Jeong HH, Jang Y, Lin T, Adamski CJ, Lavery LA, Rath S, Richman R, Bondar VV, Alcala E, Revelli JP, Orr HT, Liu Z, Botas J, Zoghbi HY. J Clin Invest. 2022 May 2;132(9). pii: 156616. doi: 10.1172/JCI156616. 10.1172/JCI156616 PubMed 35499073