pCAG1.1-Armc12 delta ARM/FLAG
(Plasmid
#180496)
-
PurposeExpression vector of ARM domain deleted mouse Armc12 tagged with FLAG at C-terminus. See Fig.4D of Shimada, K. et al. Proc. Natl. Acad. Sci. USA. 118 (6): e2018355118, 2021.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAG1.1
- Backbone size w/o insert (bp) 5184
- Total vector size (bp) 5184
-
Modifications to backbonepCAG1.1 was used as an original vector. FLAG tag sequence was added.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namearmadillo repeat containing 12
-
Alt nameArmc12
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)363
-
MutationARM domain of Armc12 is deleted
-
GenBank IDNM_026290.3
-
Entrez GeneArmc12 (a.k.a. 4930511I11Rik, AV041658)
- Promoter CAG promoter
-
Tag
/ Fusion Protein
- FLAG tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer GTTCGGCTTCTGGCGTGTGA
- 3′ sequencing primer ATAAATTTCCTTTATTAGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG1.1-Armc12 delta ARM/FLAG was a gift from Masahito Ikawa (Addgene plasmid # 180496 ; http://n2t.net/addgene:180496 ; RRID:Addgene_180496) -
For your References section:
ARMC12 regulates spatiotemporal mitochondrial dynamics during spermiogenesis and is required for male fertility. Shimada K, Park S, Miyata H, Yu Z, Morohoshi A, Oura S, Matzuk MM, Ikawa M. Proc Natl Acad Sci U S A. 2021 Feb 9;118(6). pii: 2018355118. doi: 10.1073/pnas.2018355118. 10.1073/pnas.2018355118 PubMed 33536340