Skip to main content
Addgene

pCAG1.1-Armc12 delta C/FLAG
(Plasmid #180497)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180497 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG1.1
  • Backbone size w/o insert (bp) 5184
  • Total vector size (bp) 5184
  • Modifications to backbone
    pCAG1.1 was used as an original vector. FLAG tag sequence was added.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    armadillo repeat containing 12
  • Alt name
    Armc12
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    957
  • Mutation
    C-terminus of Armc12 is deleted
  • GenBank ID
    NM_026290.3
  • Entrez Gene
    Armc12 (a.k.a. 4930511I11Rik, AV041658)
  • Promoter CAG promoter
  • Tag / Fusion Protein
    • FLAG tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer GTTCGGCTTCTGGCGTGTGA
  • 3′ sequencing primer ATAAATTTCCTTTATTAGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG1.1-Armc12 delta C/FLAG was a gift from Masahito Ikawa (Addgene plasmid # 180497 ; http://n2t.net/addgene:180497 ; RRID:Addgene_180497)
  • For your References section:

    ARMC12 regulates spatiotemporal mitochondrial dynamics during spermiogenesis and is required for male fertility. Shimada K, Park S, Miyata H, Yu Z, Morohoshi A, Oura S, Matzuk MM, Ikawa M. Proc Natl Acad Sci U S A. 2021 Feb 9;118(6). pii: 2018355118. doi: 10.1073/pnas.2018355118. 10.1073/pnas.2018355118 PubMed 33536340