pCMV-Armc12/FLAG/BioID2/HA
(Plasmid
#180498)
-
PurposeExpression vector of BirA-fused mouse Armc12. HA-tagged BirA was linked to the FLAG-tagged Armc12. See Fig.S6 of Shimada, K. et al. Proc. Natl. Acad. Sci. USA. 118 (6): e2018355118, 2021.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180498 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMCS-BioID2-HA
- Backbone size w/o insert (bp) 6112
- Total vector size (bp) 6112
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namearmadillo repeat containing 12
-
Alt nameArmc12
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1020
-
GenBank IDNM_026290.3
-
Entrez GeneArmc12 (a.k.a. 4930511I11Rik, AV041658)
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- FLAG tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTAATACGACTCACTATAGG
- 3′ sequencing primer AGCTCACGTTCCACTCCTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-Armc12/FLAG/BioID2/HA was a gift from Masahito Ikawa (Addgene plasmid # 180498 ; http://n2t.net/addgene:180498 ; RRID:Addgene_180498) -
For your References section:
ARMC12 regulates spatiotemporal mitochondrial dynamics during spermiogenesis and is required for male fertility. Shimada K, Park S, Miyata H, Yu Z, Morohoshi A, Oura S, Matzuk MM, Ikawa M. Proc Natl Acad Sci U S A. 2021 Feb 9;118(6). pii: 2018355118. doi: 10.1073/pnas.2018355118. 10.1073/pnas.2018355118 PubMed 33536340