pLX-TRV1
(Plasmid
#180515)
-
PurposeAgrobacterium tumefaciens-based expression of TRV1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180515 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLX-Z4
- Total vector size (bp) 10774
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTobacco rattle virus RNA1
- Promoter 35S CaMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGCAGCGGCAGGATATATGGC
- 3′ sequencing primer ATATATCCTGCCATCAGTCATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX-TRV1 was a gift from Jose-Antonio Daros (Addgene plasmid # 180515 ; http://n2t.net/addgene:180515 ; RRID:Addgene_180515) -
For your References section:
Simplifying plant gene silencing and genome editing logistics by a one-Agrobacterium system for simultaneous delivery of multipartite virus vectors. Aragones V, Aliaga F, Pasin F, Daros JA. Biotechnol J. 2022 Mar 24:e2100504. doi: 10.1002/biot.202100504. 10.1002/biot.202100504 PubMed 35332696