pcDNA3.1-TRBP-L1+D1+L2-myc/His
(Plasmid
#180599)
-
PurposeExpressing various parts of TRBP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180599 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRBP
-
Alt nameTARBP2
-
Alt nameTAR (HIV-1) RNA binding protein 2
-
SpeciesH. sapiens (human)
-
GenBank IDNM_134323.2
-
Entrez GeneTARBP2 (a.k.a. LOQS, TRBP, TRBP1, TRBP2)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Myc (C terminal on backbone)
- His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer aaagggaagcttatgagtgaagaggagcaaggctccgg
- 3′ sequencing primer aaaggggcggccgcgcactcagactgctgaggggagacag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-TRBP-L1+D1+L2-myc/His was a gift from Kumiko Ui-Tei (Addgene plasmid # 180599 ; http://n2t.net/addgene:180599 ; RRID:Addgene_180599) -
For your References section:
LGP2 virus sensor regulates gene expression network mediated by TRBP-bound microRNAs. Takahashi T, Nakano Y, Onomoto K, Murakami F, Komori C, Suzuki Y, Yoneyama M, Ui-Tei K. Nucleic Acids Res. 2018 Sep 28;46(17):9134-9147. doi: 10.1093/nar/gky575. 10.1093/nar/gky575 PubMed 29939295