Skip to main content

mitoZFD_ND1-Right-G1397-C
(Plasmid #180769)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180769 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p3s
  • Backbone size w/o insert (bp) 5382
  • Total vector size (bp) 6408
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mitoZFD for ND1 mutation
  • Insert Size (bp)
    1026
  • Promoter pCMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mitoZFD_ND1-Right-G1397-C was a gift from Jin-Soo Kim (Addgene plasmid # 180769 ; http://n2t.net/addgene:180769 ; RRID:Addgene_180769)
  • For your References section:

    Nuclear and mitochondrial DNA editing in human cells with zinc finger deaminases. Lim K, Cho SI, Kim JS. Nat Commun. 2022 Jan 18;13(1):366. doi: 10.1038/s41467-022-27962-0. 10.1038/s41467-022-27962-0 PubMed 35042880