Phage-PGK-GFP-T(WT)
(Plasmid
#181736)
-
Purposefor lentiviral expression of brachyury ORF in mammalian cells
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 181736 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePhage-PGK-GFP-DEST
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT (brachyury)
-
SpeciesH. sapiens (human)
-
Mutationa silent mutation in the PAM site of an sgRNAt targeting enodgenous T (sg_T: CCCTGAGACCCAGTTCATAG) at amino acid 194 - C to T at position 3 of alanine
Cloning Information
- Cloning method Gateway Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Phage-PGK-GFP-T(WT) was a gift from Charles Lin (Addgene plasmid # 181736 ; http://n2t.net/addgene:181736 ; RRID:Addgene_181736)