pAAV-EF1α-DIO-CFL-SN
(Plasmid
#181740)
-
PurposeAAV vector for expressing CFL-SN
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 181740 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5604
- Total vector size (bp) 6828
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCFL-SN
-
Alt namehuman Cofilin and SuperNova (monomeric photosensitizing fluorescent protein for chromophore-assisted light inactivation)
-
SpeciesH. sapiens (human), Synthetic
- Promoter EF1alpha
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
As descried above, SN was developed by Dr. Takeharu Nagai (Osaka University).
https://www.addgene.org/53234/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1α-DIO-CFL-SN was a gift from Yasunori Hayashi (Addgene plasmid # 181740 ; http://n2t.net/addgene:181740 ; RRID:Addgene_181740) -
For your References section:
Stepwise synaptic plasticity events drive the early phase of memory consolidation. Goto A, Bota A, Miya K, Wang J, Tsukamoto S, Jiang X, Hirai D, Murayama M, Matsuda T, McHugh TJ, Nagai T, Hayashi Y. Science. 2021 Nov 12;374(6569):857-863. doi: 10.1126/science.abj9195. Epub 2021 Nov 11. 10.1126/science.abj9195 PubMed 34762472