Skip to main content
Addgene

pAAV-EF1α-DIO-CFL-SN
(Plasmid #181740)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 181740 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5604
  • Total vector size (bp) 6828
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CFL-SN
  • Alt name
    human Cofilin and SuperNova (monomeric photosensitizing fluorescent protein for chromophore-assisted light inactivation)
  • Species
    H. sapiens (human), Synthetic
  • Promoter EF1alpha

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

As descried above, SN was developed by Dr. Takeharu Nagai (Osaka University).
https://www.addgene.org/53234/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1α-DIO-CFL-SN was a gift from Yasunori Hayashi (Addgene plasmid # 181740 ; http://n2t.net/addgene:181740 ; RRID:Addgene_181740)
  • For your References section:

    Stepwise synaptic plasticity events drive the early phase of memory consolidation. Goto A, Bota A, Miya K, Wang J, Tsukamoto S, Jiang X, Hirai D, Murayama M, Matsuda T, McHugh TJ, Nagai T, Hayashi Y. Science. 2021 Nov 12;374(6569):857-863. doi: 10.1126/science.abj9195. Epub 2021 Nov 11. 10.1126/science.abj9195 PubMed 34762472