Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-EF1α-DIO-CFL-SN
(Plasmid #181740)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 181740 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5604
  • Total vector size (bp) 6828
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CFL-SN
  • Alt name
    human Cofilin and SuperNova (monomeric photosensitizing fluorescent protein for chromophore-assisted light inactivation)
  • Species
    H. sapiens (human), Synthetic
  • Promoter EF1alpha

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

As descried above, SN was developed by Dr. Takeharu Nagai (Osaka University).
https://www.addgene.org/53234/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1α-DIO-CFL-SN was a gift from Yasunori Hayashi (Addgene plasmid # 181740 ; http://n2t.net/addgene:181740 ; RRID:Addgene_181740)
  • For your References section:

    Stepwise synaptic plasticity events drive the early phase of memory consolidation. Goto A, Bota A, Miya K, Wang J, Tsukamoto S, Jiang X, Hirai D, Murayama M, Matsuda T, McHugh TJ, Nagai T, Hayashi Y. Science. 2021 Nov 12;374(6569):857-863. doi: 10.1126/science.abj9195. Epub 2021 Nov 11. 10.1126/science.abj9195 PubMed 34762472