Skip to main content
Addgene

pShHELIX(Cas12k-TniQ-TniQ)-sgRNA_entry (CJT112)
(Plasmid #181791)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 181791 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nAniI-ShTnsB, ShTnsC, ShCas12k-ShTniQ-ShTniQ
  • Species
    Synthetic
  • Mutation
    nAniI = K227M, F80K, L232K
  • Promoter Lac and J23119

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACGCCAAGCTCCAAAACGATCTCA
  • 3′ sequencing primer gctagcattatacctaggactgagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pShHELIX(Cas12k-TniQ-TniQ)-sgRNA_entry (CJT112) was a gift from Benjamin Kleinstiver (Addgene plasmid # 181791 ; http://n2t.net/addgene:181791 ; RRID:Addgene_181791)
  • For your References section:

    Precise cut-and-paste DNA insertion using engineered type V-K CRISPR-associated transposases. Tou CJ, Orr B, Kleinstiver BP. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01574-x. 10.1038/s41587-022-01574-x PubMed 36593413