pDonor14-ShHELIX-KanR (CJT70)
(Plasmid
#181793)
-
PurposepDonor for ShHELIX containing 14bp of spacing between the I-AniI site and LE/RE and encoding a kanamycin resistance gene as cargo
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 181793 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC19, R6K origin of replication
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameKanR, R6K origin of replication
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgacgccgttggatacaccaagg
- 3′ sequencing primer ttgagtgacacaggaacacttaac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.01.07.475005v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDonor14-ShHELIX-KanR (CJT70) was a gift from Benjamin Kleinstiver (Addgene plasmid # 181793 ; http://n2t.net/addgene:181793 ; RRID:Addgene_181793) -
For your References section:
Precise cut-and-paste DNA insertion using engineered type V-K CRISPR-associated transposases. Tou CJ, Orr B, Kleinstiver BP. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01574-x. 10.1038/s41587-022-01574-x PubMed 36593413