MS2-pegRNA
(Plasmid
#181811)
-
Purposems2 incorporated pegRNA-1.1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 181811 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneU6
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMS2-pegRNA
-
gRNA/shRNA sequenceCACCTTCAGCTTGGCGGTCT
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MS2-pegRNA was a gift from Erik Sontheimer (Addgene plasmid # 181811 ; http://n2t.net/addgene:181811 ; RRID:Addgene_181811) -
For your References section:
A split prime editor with untethered reverse transcriptase and circular RNA template. Liu B, Dong X, Cheng H, Zheng C, Chen Z, Rodriguez TC, Liang SQ, Xue W, Sontheimer EJ. Nat Biotechnol. 2022 Apr 4. pii: 10.1038/s41587-022-01255-9. doi: 10.1038/s41587-022-01255-9. 10.1038/s41587-022-01255-9 PubMed 35379962