pAAV-MCU-tDimer
(Plasmid
#181865)
-
PurposeExpresses tDimer-tagged mitochondrial calcium uniporter (MCU) under control of the CaMKIIa promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 181865 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV-CaMKIIa
-
Vector typeMammalian Expression, Adenoviral, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemitochondrial calcium uniporter
-
Alt nameMCU
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1059
-
GenBank IDNM_001033259.4
-
Entrez GeneMcu (a.k.a. 2010012O16Rik, C10orf42, Ccdc109a, D130073L02Rik, Gm64)
- Promoter CaMKIIa
-
Tag
/ Fusion Protein
- tDimer (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer TGGGGACCTGGATGCTGACGAA
- 3′ sequencing primer ACGGGAAGCAATAGCATGATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byOrigene, MC212635
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-MCU-tDimer was a gift from Hilmar Bading (Addgene plasmid # 181865 ; http://n2t.net/addgene:181865 ; RRID:Addgene_181865) -
For your References section:
Mitochondrial calcium uniporter Mcu controls excitotoxicity and is transcriptionally repressed by neuroprotective nuclear calcium signals. Qiu J, Tan YW, Hagenston AM, Martel MA, Kneisel N, Skehel PA, Wyllie DJ, Bading H, Hardingham GE. Nat Commun. 2013;4:2034. doi: 10.1038/ncomms3034. 10.1038/ncomms3034 PubMed 23774321