Skip to main content

pAAV-MCU-tDimer
(Plasmid #181865)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 181865 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-CaMKIIa
  • Vector type
    Mammalian Expression, Adenoviral, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mitochondrial calcium uniporter
  • Alt name
    MCU
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1059
  • GenBank ID
    NM_001033259.4
  • Entrez Gene
    Mcu (a.k.a. 2010012O16Rik, C10orf42, Ccdc109a, D130073L02Rik, Gm64)
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • tDimer (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer TGGGGACCTGGATGCTGACGAA
  • 3′ sequencing primer ACGGGAAGCAATAGCATGATAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Origene, MC212635

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-MCU-tDimer was a gift from Hilmar Bading (Addgene plasmid # 181865 ; http://n2t.net/addgene:181865 ; RRID:Addgene_181865)
  • For your References section:

    Mitochondrial calcium uniporter Mcu controls excitotoxicity and is transcriptionally repressed by neuroprotective nuclear calcium signals. Qiu J, Tan YW, Hagenston AM, Martel MA, Kneisel N, Skehel PA, Wyllie DJ, Bading H, Hardingham GE. Nat Commun. 2013;4:2034. doi: 10.1038/ncomms3034. 10.1038/ncomms3034 PubMed 23774321