Skip to main content

pTwist-SFFV-NFE2L18ND-Puro
(Plasmid #181918)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 181918 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTwist-SFFV-Puro
  • Backbone manufacturer
    Twist Biosciences
  • Backbone size w/o insert (bp) 7502
  • Total vector size (bp) 9839
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NFE2L1
  • Alt name
    NRF1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2337
  • Mutation
    8 putative N-glycoyslation sites converted from asparagine to aspartic acid
  • Entrez Gene
    NFE2L1 (a.k.a. LCR-F1, NRF-1, NRF1, TCF11)
  • Promoter SFFV
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gcttctcgcttctgttcgcg
  • 3′ sequencing primer caccggccttattccaagcg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Custom synthesis with Twist Biosciences

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTwist-SFFV-NFE2L18ND-Puro was a gift from Scott Dixon (Addgene plasmid # 181918 ; http://n2t.net/addgene:181918 ; RRID:Addgene_181918)
  • For your References section:

    Ferroptosis regulation by the NGLY1/NFE2L1 pathway. Forcina GC, Pope L, Murray M, Dong W, Abu-Remaileh M, Bertozzi CR, Dixon SJ. Proc Natl Acad Sci U S A. 2022 Mar 15;119(11):e2118646119. doi: 10.1073/pnas.2118646119. Epub 2022 Mar 10. 10.1073/pnas.2118646119 PubMed 35271393