pTwist-SFFV-NFE2L18ND-Puro
(Plasmid
#181918)
-
PurposeLentiviral plasmid that directs the expression of mutant NFE2L1/Nrf1 where 8 putative N-glycosites are mutated from asparagine to aspartic acid in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 181918 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTwist-SFFV-Puro
-
Backbone manufacturerTwist Biosciences
- Backbone size w/o insert (bp) 7502
- Total vector size (bp) 9839
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNFE2L1
-
Alt nameNRF1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2337
-
Mutation8 putative N-glycoyslation sites converted from asparagine to aspartic acid
-
Entrez GeneNFE2L1 (a.k.a. LCR-F1, NRF-1, NRF1, TCF11)
- Promoter SFFV
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- HA (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gcttctcgcttctgttcgcg
- 3′ sequencing primer caccggccttattccaagcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCustom synthesis with Twist Biosciences
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTwist-SFFV-NFE2L18ND-Puro was a gift from Scott Dixon (Addgene plasmid # 181918 ; http://n2t.net/addgene:181918 ; RRID:Addgene_181918) -
For your References section:
Ferroptosis regulation by the NGLY1/NFE2L1 pathway. Forcina GC, Pope L, Murray M, Dong W, Abu-Remaileh M, Bertozzi CR, Dixon SJ. Proc Natl Acad Sci U S A. 2022 Mar 15;119(11):e2118646119. doi: 10.1073/pnas.2118646119. Epub 2022 Mar 10. 10.1073/pnas.2118646119 PubMed 35271393