pLeGO.sgGata1.4.RUNX1A.iG2
(Plasmid
#181976)
-
Purposegene knock out of mouse GATA1, overexpression of 3xFLAG-RUNX1A (human)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 181976 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLeGO.iG2
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGATA1 gRNA: CCTAGACCAGGAAAATCCAT
-
SpeciesM. musculus (mouse)
-
Entrez GeneGata1 (a.k.a. Gata-1, Gf-1, eryf1)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Gene/Insert 2
-
Gene/Insert nameRUNX1A
-
Alt nameRUNX family transcription factor 1 (RUNX1), transcript variant 3
-
SpeciesH. sapiens (human)
-
Entrez GeneRUNX1 (a.k.a. AML1, AML1-EVI-1, AMLCR1, CBF2alpha, CBFA2, EVI-1, PEBP2aB, PEBP2alpha)
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLeGO.sgGata1.4.RUNX1A.iG2 was a gift from Jan-Henning Klusmann (Addgene plasmid # 181976 ; http://n2t.net/addgene:181976 ; RRID:Addgene_181976) -
For your References section:
RUNX1 isoform disequilibrium promotes the development of trisomy 21-associated myeloid leukemia. Gialesaki S, Brauer-Hartmann D, Issa H, Bhayadia R, Alejo-Valle O, Verboon L, Schmell AL, Laszig S, Regenyi E, Schuschel K, Labuhn M, Ng M, Winkler R, Ihling C, Sinz A, Glass M, Huttelmaier S, Matzk S, Schmid L, Struwe FJ, Kadel SK, Reinhardt D, Yaspo ML, Heckl D, Klusmann JH. Blood. 2023 Mar 9;141(10):1105-1118. doi: 10.1182/blood.2022017619. 10.1182/blood.2022017619 PubMed 36493345