Skip to main content

pLeGO.sgGata1.4.RUNX1A.iG2
(Plasmid #181976)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 181976 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLeGO.iG2
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    GATA1 gRNA: CCTAGACCAGGAAAATCCAT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Gata1 (a.k.a. Gata-1, Gf-1, eryf1)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Gene/Insert 2

  • Gene/Insert name
    RUNX1A
  • Alt name
    RUNX family transcription factor 1 (RUNX1), transcript variant 3
  • Species
    H. sapiens (human)
  • Entrez Gene
    RUNX1 (a.k.a. AML1, AML1-EVI-1, AMLCR1, CBF2alpha, CBFA2, EVI-1, PEBP2aB, PEBP2alpha)
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLeGO.sgGata1.4.RUNX1A.iG2 was a gift from Jan-Henning Klusmann (Addgene plasmid # 181976 ; http://n2t.net/addgene:181976 ; RRID:Addgene_181976)
  • For your References section:

    RUNX1 isoform disequilibrium promotes the development of trisomy 21-associated myeloid leukemia. Gialesaki S, Brauer-Hartmann D, Issa H, Bhayadia R, Alejo-Valle O, Verboon L, Schmell AL, Laszig S, Regenyi E, Schuschel K, Labuhn M, Ng M, Winkler R, Ihling C, Sinz A, Glass M, Huttelmaier S, Matzk S, Schmid L, Struwe FJ, Kadel SK, Reinhardt D, Yaspo ML, Heckl D, Klusmann JH. Blood. 2023 Mar 9;141(10):1105-1118. doi: 10.1182/blood.2022017619. 10.1182/blood.2022017619 PubMed 36493345