pIVT-osTIR1-9myc
(Plasmid
#182043)
-
Purposein vitro transcription of osTIR1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182043 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIVT
- Backbone size w/o insert (bp) 3045
- Total vector size (bp) 5139
-
Vector typein vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameosTIR1
-
Alt nameOryza sativa (rice) TIR1 auxin receptor
-
SpeciesOryza sativa
-
Insert Size (bp)2094
-
Tag
/ Fusion Protein
- myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GAAGCTCAGAATAAACGC
- 3′ sequencing primer ATTCGGGTGTTCTTGAGGCTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIVT-osTIR1-9myc was a gift from Janice Evans (Addgene plasmid # 182043 ; http://n2t.net/addgene:182043 ; RRID:Addgene_182043) -
For your References section:
Auxin-inducible protein degradation as a novel approach for protein depletion and reverse genetic discoveries in mammalian oocytesdagger. Camlin NJ, Evans JP. Biol Reprod. 2019 Oct 25;101(4):704-718. doi: 10.1093/biolre/ioz113. 10.1093/biolre/ioz113 PubMed 31299080