Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pIVT-AIDm-EGFP
(Plasmid #182044)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 182044 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIVT
  • Backbone size w/o insert (bp) 3056
  • Total vector size (bp) 3926
  • Vector type
    in vitro transcription

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AIDm-EGFP
  • Alt name
    AtIAA17 (amino acids 63–109)
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    870
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GAAGCTCAGAATAAACGC
  • 3′ sequencing primer ATTCGGGTGTTCTTGAGGCTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIVT-AIDm-EGFP was a gift from Janice Evans (Addgene plasmid # 182044 ; http://n2t.net/addgene:182044 ; RRID:Addgene_182044)
  • For your References section:

    Auxin-inducible protein degradation as a novel approach for protein depletion and reverse genetic discoveries in mammalian oocytesdagger. Camlin NJ, Evans JP. Biol Reprod. 2019 Oct 25;101(4):704-718. doi: 10.1093/biolre/ioz113. 10.1093/biolre/ioz113 PubMed 31299080