Skip to main content

KI-eab2-GA
(Plasmid #182160)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182160 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTol2-eab2-GA
  • Backbone size w/o insert (bp) 7588
  • Total vector size (bp) 8118
  • Vector type
    Zebrafish Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Homologous arm
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    530
  • Promoter eab2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NsiI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CCACACAGGTCAGAGGTTTGTCC
  • 3′ sequencing primer GCATTGGAAAGGGTCGCTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    KI-eab2-GA was a gift from Hui Zong (Addgene plasmid # 182160 ; http://n2t.net/addgene:182160 ; RRID:Addgene_182160)
  • For your References section:

    zMADM (zebrafish mosaic analysis with double markers) for single-cell gene knockout and dual-lineage tracing. Xu B, Kucenas S, Zong H. Proc Natl Acad Sci U S A. 2022 Mar 1;119(9). pii: 2122529119. doi: 10.1073/pnas.2122529119. 10.1073/pnas.2122529119 PubMed 35197298