Skip to main content

pAAV-iCre-2A-cherry
(Plasmid #182246)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182246 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pUC
  • Backbone size w/o insert (bp) 3100
  • Total vector size (bp) 7483
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pan neuronal gene promoter (hdc) fragment driving iCre recombinase and 2A linked to mCherry
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    4400
  • GenBank ID
    15186
  • Promoter fragment of histidine decarboxylase gene promoter that gives pan-neuronal expression

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CATCCACTAAAGGGACTTCCAG
  • 3′ sequencing primer CTGGAAGGGATCTTTGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-iCre-2A-cherry was a gift from William Wisden (Addgene plasmid # 182246 ; http://n2t.net/addgene:182246 ; RRID:Addgene_182246)
  • For your References section:

    NMDA Receptors in the Lateral Preoptic Hypothalamus Are Essential for Sustaining NREM and REM Sleep. Miracca G, Anuncibay-Soto B, Tossell K, Yustos R, Vyssotski AL, Franks NP, Wisden W. J Neurosci. 2022 May 31. pii: JNEUROSCI.0350-21.2022. doi: 10.1523/JNEUROSCI.0350-21.2022. 10.1523/JNEUROSCI.0350-21.2022 PubMed 35649726