pAAV-iCre-2A-cherry
(Plasmid
#182246)
-
PurposeExpresses iCre linked to mCherry. The promoter is a fragment of the hdc gene promoter which drives pan neuronal expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182246 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 3100
- Total vector size (bp) 7483
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepan neuronal gene promoter (hdc) fragment driving iCre recombinase and 2A linked to mCherry
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)4400
-
GenBank ID15186
- Promoter fragment of histidine decarboxylase gene promoter that gives pan-neuronal expression
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CATCCACTAAAGGGACTTCCAG
- 3′ sequencing primer CTGGAAGGGATCTTTGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-iCre-2A-cherry was a gift from William Wisden (Addgene plasmid # 182246 ; http://n2t.net/addgene:182246 ; RRID:Addgene_182246) -
For your References section:
NMDA Receptors in the Lateral Preoptic Hypothalamus Are Essential for Sustaining NREM and REM Sleep. Miracca G, Anuncibay-Soto B, Tossell K, Yustos R, Vyssotski AL, Franks NP, Wisden W. J Neurosci. 2022 May 31. pii: JNEUROSCI.0350-21.2022. doi: 10.1523/JNEUROSCI.0350-21.2022. 10.1523/JNEUROSCI.0350-21.2022 PubMed 35649726