Skip to main content

CMV-H2B-mScarlet-I
(Plasmid #182297)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182297 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    H2B-GFP
  • Backbone manufacturer
    Geoff Wahl Lab (Addgene #11680)
  • Backbone size w/o insert (bp) 4390
  • Total vector size (bp) 5086
  • Modifications to backbone
    eGFP sequence was removed and replaced by mScarlet-I
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mScarlet-I
  • Species
    Synthetic
  • Insert Size (bp)
    696
  • Tag / Fusion Protein
    • mScarlet-I (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site MfeI (unknown if destroyed)
  • 5′ sequencing primer TGAACCGTCAGATCCGCTAG
  • 3′ sequencing primer GGCTGATTATGATCTAGAGTCGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A portion of this plasmid was derived from a plasmid made by Gadella Lab (Addgene #85086)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-H2B-mScarlet-I was a gift from Severine Degrelle & Thierry Fournier (Addgene plasmid # 182297 ; http://n2t.net/addgene:182297 ; RRID:Addgene_182297)
  • For your References section:

    Novel fluorescent and secreted transcriptional reporters for quantifying activity of the xenobiotic sensor aryl hydrocarbon receptor (AHR). Degrelle SA, Ferecatu I, Fournier T. Environ Int. 2022 Sep 24;169:107545. doi: 10.1016/j.envint.2022.107545. 10.1016/j.envint.2022.107545 PubMed 36179647