N1-Mito-pHCountdown
(Plasmid
#182303)
-
Purposemammalian cell plasmid encoding pH-Countdown targeted to mitochondria via fusion to the COX8A presequence
-
Depositing Lab
-
Depositing OrganizationCalico Life Sciences LLC
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182303 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 182303-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 182303-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneN1
- Backbone size w/o insert (bp) 3282
- Total vector size (bp) 4750
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemitochondria targeted pH countdown
-
SpeciesEchinophyllia sp. SC22
-
Insert Size (bp)819
- Promoter CMV
-
Tag
/ Fusion Protein
- COX8A mitochondria targeting sequence (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint here: https://andrewgyork.github.io/relaxation_sensors/, doi:10.5281/zenodo.5810930
DNA (Catalog # 182303-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 182303-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
N1-Mito-pHCountdown was a gift from Andrew York (Addgene plasmid # 182303 ; http://n2t.net/addgene:182303 ; RRID:Addgene_182303) -
For your References section:
Relaxation Sensors. Seidel ZP, Wang JCK, Riegler J, York AG, Ingaramo M. (2021), doi: 10.5281/zenodo.5810930 10.5281/zenodo.5810930
Map uploaded by the depositor.
