Skip to main content

Kohinoor 2.0/pcDNA3
(Plasmid #182315)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182315 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kohinoor 2.0
  • Species
    Synthetic
  • Insert Size (bp)
    675
  • GenBank ID
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • No tag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TGGCTAACTAGAGAACCCACTG
  • 3′ sequencing primer AGCTCTAGCATTTAGGTGACAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Kohinoor 2.0/pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 182315 ; http://n2t.net/addgene:182315 ; RRID:Addgene_182315)
  • For your References section:

    A photoswitchable fluorescent protein for hours-time-lapse and sub-second-resolved super-resolution imaging. Wazawa T, Noma R, Uto S, Sugiura K, Washio T, Nagai T. Microscopy (Oxf). 2021 Aug 9;70(4):340-352. doi: 10.1093/jmicro/dfab001. 10.1093/jmicro/dfab001 PubMed 33481018