Kohinoor 2.0/pcDNA3
(Plasmid
#182315)
-
PurposePositively reversibly photoswitchable fluorescent protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182315 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKohinoor 2.0
-
SpeciesSynthetic
-
Insert Size (bp)675
-
GenBank ID
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- No tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TGGCTAACTAGAGAACCCACTG
- 3′ sequencing primer AGCTCTAGCATTTAGGTGACAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Kohinoor 2.0/pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 182315 ; http://n2t.net/addgene:182315 ; RRID:Addgene_182315) -
For your References section:
A photoswitchable fluorescent protein for hours-time-lapse and sub-second-resolved super-resolution imaging. Wazawa T, Noma R, Uto S, Sugiura K, Washio T, Nagai T. Microscopy (Oxf). 2021 Aug 9;70(4):340-352. doi: 10.1093/jmicro/dfab001. 10.1093/jmicro/dfab001 PubMed 33481018