Skip to main content

CMV-FOXA1-T2A-eGFP
(Plasmid #182337)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182337 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.3-TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 6159
  • Total vector size (bp) 7575
  • Modifications to backbone
    Inserted T2A-eGFP at 3' terminal of MCS.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Forkhead Box A1
  • Alt name
    FOXA1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1416
  • GenBank ID
    NM_004496
  • Entrez Gene
    FOXA1 (a.k.a. HNF3A, TCF3A)
  • Promoter CMV
  • Tag / Fusion Protein
    • T2A-eGFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAGAAGACACCGGGACCGAT
  • 3′ sequencing primer GGATTCTCCTCCACGTCACC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    FOXA1 was subcloned from Harvard Institute of Proteomics (HsCD00082189)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-FOXA1-T2A-eGFP was a gift from Jennifer Mitchell (Addgene plasmid # 182337 ; http://n2t.net/addgene:182337 ; RRID:Addgene_182337)
  • For your References section:

    Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Abatti LE, Lado-Fernandez P, Huynh L, Collado M, Hoffman MM, Mitchell JA. Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734. 10.1093/nar/gkad734 PubMed 37738673