Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSEM376 - sgRNA - spc4 - array - insertion - unc-119 - locus
(Plasmid #182344)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 182344 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTwist-Amp-high-copy
  • Backbone manufacturer
    Twist Biosciences
  • Total vector size (bp) 5028
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Spacer 4
  • gRNA/shRNA sequence
    GTTTGGGAACCAGGTGTTGG
  • Species
    C. elegans (nematode)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

www.wormbuilder.org
MOdular Safe harbor Transgene Insertion (mosTI).
sgRNA4 for insertion of arrays into the ce-unc-119 genomic locus. Use with pSEM371 fragment included in Ex array injected into, for example, unc-119(ed3).

Please visit https://www.biorxiv.org/content/10.1101/2022.04.19.488726v1.full for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSEM376 - sgRNA - spc4 - array - insertion - unc-119 - locus was a gift from Christian Froekjaer-Jensen (Addgene plasmid # 182344 ; http://n2t.net/addgene:182344 ; RRID:Addgene_182344)
  • For your References section:

    Modular safe-harbor transgene insertion (MosTI) for targeted single-copy and extrachromosomal array integration in C. elegans. El Mouridi S, Alkhaldi F, Frokjaer-Jensen C. G3 (Bethesda). 2022 Jul 28. pii: 6651068. doi: 10.1093/g3journal/jkac184. 10.1093/g3journal/jkac184 PubMed 35900171