Linked mRuby3 VLP
(Plasmid
#182430)
-
PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and fusion protein VP2C-GFP-mRuby3 (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182430 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepILGFPB5A
-
Vector typeYeast Expression, Synthetic Biology
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameVP2C-GFP-mRuby3
-
Alt nameVP2C-yEGFP-mRuby3, VP2C-GFP-RFP
-
SpeciesSynthetic; Murine polyomavirus
-
Insert Size (bp)1665
- Promoter GAL10
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGGTAATGCCATGTAATATGATTATTAAAC
- 3′ sequencing primer GCATTGGCACGGTGCAACAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namedeltaVP1
-
Alt nameVP1, deltaNLS VP1
-
SpeciesSynthetic; Murine polyomavirus
-
Insert Size (bp)1143
- Promoter GAL1
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTTCTTATTCAAATGTCATAAAAGTATCAAC
- 3′ sequencing primer CCAGCCTGCTTTTCTGTAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
mRuby3 is slow to mature at 30 degC. Further incubation at 37 degC required after protein purification for complete fluorophore maturation.
Please visit https://www.biorxiv.org/content/10.1101/2022.11.24.517869v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Linked mRuby3 VLP was a gift from Claudia Vickers (Addgene plasmid # 182430 ; http://n2t.net/addgene:182430 ; RRID:Addgene_182430) -
For your References section:
Synthetic in vivo compartmentalisation improves metabolic flux and modulates the product profile of promiscuous enzymes. Li Chen Cheah , Lian Liu , Manuel R. Plan, Bingyin Peng , Zeyu Lu , Gerhard Schenk , Claudia E. Vickers , Frank Sainsbury. BioRxiv, 2022 10.1101/2022.11.24.517869