deltaVP1d63C + VP2C-GFPdeg
(Plasmid
#182481)
-
PurposeYIp for expressing Murine polyomavirus deltaVP1 with the 63 C-ter residues truncated (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil marker (K. lactis URA3).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182481 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepILGFPB5A
-
Vector typeYeast Expression, Synthetic Biology ; Metabolic engineering
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameVP2C-GFPdeg
-
Alt nameVP2C-yEGFPdeg, VP2C-GFPmodc, destabilised GFP, degron-tagged GFP
-
SpeciesM. musculus (mouse), Synthetic; Murine polyomavirus
-
Insert Size (bp)1038
- Promoter GAL10
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGGTAATGCCATGTAATATGATTATTAAAC
- 3′ sequencing primer GCATTGGCACGGTGCAACAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namedeltaVP1d63C
-
Alt nameVP1, deltaNLS VP1, C-terminal truncated VP1
-
SpeciesSynthetic; Murine polyomavirus
-
Insert Size (bp)954
- Promoter GAL1
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTTCTTATTCAAATGTCATAAAAGTATCAAC
- 3′ sequencing primer CCAGCCTGCTTTTCTGTAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
VP1 has 63 residues removed from the C-terminal. This abolishes in-vivo assembly in yeast.
Please visit https://www.biorxiv.org/content/10.1101/2022.11.24.517869v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
deltaVP1d63C + VP2C-GFPdeg was a gift from Claudia Vickers (Addgene plasmid # 182481 ; http://n2t.net/addgene:182481 ; RRID:Addgene_182481) -
For your References section:
Synthetic in vivo compartmentalisation improves metabolic flux and modulates the product profile of promiscuous enzymes. Cheah LC, Liu L, Plan MR, Peng B, Lu Z, Schenk G, Vickers CE, Sainsbury F. bioRxiv 2022.11.24.517869 10.1101/2022.11.24.517869