Coexpressed Free deadFPPS-NES
(Plasmid
#182492)
-
PurposeYeast integrative plasmid for expressing ERG20 (GAL10 promoter) and fusion protein deadFPPS-AcNES1 (GAL7 promoter). deadFPPS is ERG20(K197G-K254A), an inactive mutant of ERG20.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182492 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepILGFPB5A
-
Vector typeYeast Expression, Synthetic Biology ; Metabolic engineering
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFPPS
-
Alt nameERG20, wtERG20, farnesyl diphosphate synthase
-
SpeciesS. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)1059
- Promoter GAL10
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGGTAATGCCATGTAATATGATTATTAAAC
- 3′ sequencing primer CTCAACAGTGCTCCGAAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namedeadFPPS-NES
-
Alt nameERG20(K197G-K254A)-AcNES1, farnesyl diphosphate synthase (inactive), nerolidol/linalool synthase
-
SpeciesSynthetic; Actinidia chinensis
-
Insert Size (bp)2481
- Promoter GAL7
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TAGTATTCGTTTGGTAAAGTAGAGG
- 3′ sequencing primer GCATTGGCACGGTGCAACAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
deadFPPS sequence also contains G253D mutation that was inadvertently introduced during cloning.
Please visit https://www.biorxiv.org/content/10.1101/2022.11.08.515726v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Coexpressed Free deadFPPS-NES was a gift from Claudia Vickers (Addgene plasmid # 182492 ; http://n2t.net/addgene:182492 ; RRID:Addgene_182492) -
For your References section:
Metabolic flux enhancement from the translational fusion of terpene synthases is linked to terpene synthase accumulation. Cheah LC, Liu L, Stark T, Plan MR, Peng B, Lu Z, Schenk G, Sainsbury F, Vickers CE. Metab Eng. 2023 May;77:143-151. doi: 10.1016/j.ymben.2023.03.012. Epub 2023 Mar 28. 10.1016/j.ymben.2023.03.012 PubMed 36990382