Skip to main content

pAAV TRE-Tight CheRiff-mKate2
(Plasmid #182493)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182493 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene -Agilent
  • Backbone size w/o insert (bp) 4423
  • Total vector size (bp) 6178
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CheRiff (#51697 Adam Cohen Lab)
  • Alt name
    ChR64
  • Species
    Synthetic
  • Insert Size (bp)
    1023
  • Promoter TRE-Tight (Clontech)
  • Tag / Fusion Protein
    • mKate2 (Evrogen) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer atgtcgaggtaggcgtgta
  • 3′ sequencing primer GGCATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    CheRiff-eGFP was from Adam Cohen Lab Addgene # 51697. mKate2 from Evrogen

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2020.08.29.273391 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV TRE-Tight CheRiff-mKate2 was a gift from Thomas Oertner (Addgene plasmid # 182493 ; http://n2t.net/addgene:182493 ; RRID:Addgene_182493)
  • For your References section:

    ΔFosB accumulation in hippocampal granule cells drives cFos pattern separation during spatial learning. Lamothe-Molina PJ, Franzelin A, Beck L, Li D, Auksutat L, Fieblinger T, Laprell L, Alhbeck J, Gee CE, Kneussel M, Engel AK, Hilgetag CC, Morellini F, Oertner TG. Nat Commun. 2022 Oct 26;13(1):6376. doi: 10.1038/s41467-022-33947-w. 10.1038/s41467-022-33947-w PubMed 36289226