pAAV TRE-Tight CheRiff-mKate2
(Plasmid #182493)

• Purpose: Expression of CheRiff channelrhodopsin linked to mKate2 from a Tet-inducible promoter
• Depositing Lab: Thomas Oertner
• Publication: Lamothe-Molina et al Nat Commun. 2022 Oct 26;13(1):6376. doi: 10.1038/s41467-022-33947-w.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
• How this works:
  • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene -Agilent
• Backbone size w/o insert (bp): 4423
• Total vector size (bp): 6178
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CheRiff (#51697 Adam Cohen Lab)
• Alt name: ChR64
• Species: Synthetic
• Insert Size (bp): 1023
• Promoter: TRE-Tight (Clontech)
• Tag / Fusion Protein:
  • mKate2 (Evrogen) (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: atgtcgaggtaggcgtgta
• 3′ sequencing primer: GGCATTAAAGCAGCGTATCC

Resource Information

• Supplemental Documents:
  • pAAV TRE-Tight CheRiff-mKate2.gb
• A portion of this plasmid was derived from a plasmid made by: CheRiff-eGFP was from Adam Cohen Lab Addgene # 51697. mKate2 from Evrogen

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2020.08.29.273391 for bioRxiv preprint.