pAAV TRE-Tight CheRiff-mKate2
(Plasmid
#182493)
-
PurposeExpression of CheRiff channelrhodopsin linked to mKate2 from a Tet-inducible promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182493 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene -Agilent
- Backbone size w/o insert (bp) 4423
- Total vector size (bp) 6178
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCheRiff (#51697 Adam Cohen Lab)
-
Alt nameChR64
-
SpeciesSynthetic
-
Insert Size (bp)1023
- Promoter TRE-Tight (Clontech)
-
Tag
/ Fusion Protein
- mKate2 (Evrogen) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer atgtcgaggtaggcgtgta
- 3′ sequencing primer GGCATTAAAGCAGCGTATCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCheRiff-eGFP was from Adam Cohen Lab Addgene # 51697. mKate2 from Evrogen
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2020.08.29.273391 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV TRE-Tight CheRiff-mKate2 was a gift from Thomas Oertner (Addgene plasmid # 182493 ; http://n2t.net/addgene:182493 ; RRID:Addgene_182493) -
For your References section:
ΔFosB accumulation in hippocampal granule cells drives cFos pattern separation during spatial learning. Lamothe-Molina PJ, Franzelin A, Beck L, Li D, Auksutat L, Fieblinger T, Laprell L, Alhbeck J, Gee CE, Kneussel M, Engel AK, Hilgetag CC, Morellini F, Oertner TG. Nat Commun. 2022 Oct 26;13(1):6376. doi: 10.1038/s41467-022-33947-w. 10.1038/s41467-022-33947-w PubMed 36289226