Skip to main content
Addgene

pTET GFP10-FRB/FKBP-GFP11
(Plasmid #182497)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182497 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTET (PROTET)
  • Total vector size (bp) 3987
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    FRB
  • Alt name
    FRB domain of mTOR
  • Species
    H. sapiens (human), Synthetic
  • Promoter TET
  • Tag / Fusion Protein
    • split GFP10 tripartite (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer TCGAGTCCCTATCAGTGATAGAG
  • 3′ sequencing primer CGGATTTGTCCTACTCAGGAGAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    FKBP
  • Alt name
    FK506 binding protein 1A
  • Species
    M. musculus (mouse), Synthetic
  • Entrez Gene
    Fkbp1a (a.k.a. FKBP12, Fkbp, Fkbp1)
  • Promoter TET
  • Tag / Fusion Protein
    • split GFP11 tripartite (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TCGAGTCCCTATCAGTGATAGAG
  • 3′ sequencing primer CGGATTTGTCCTACTCAGGAGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTET GFP10-FRB/FKBP-GFP11 was a gift from Stéphanie Cabantous (Addgene plasmid # 182497 ; http://n2t.net/addgene:182497 ; RRID:Addgene_182497)
  • For your References section:

    High-Throughput Protein-Protein Interaction Assays Using Tripartite Split-GFP Complementation. Pedelacq JD, Waldo GS, Cabantous S. Methods Mol Biol. 2019;2025:423-437. doi: 10.1007/978-1-4939-9624-7_20. 10.1007/978-1-4939-9624-7_20 PubMed 31267465