MCS-3_Endofin_LgBiT
(Plasmid
#182574)
-
PurposeThis plasmid can be used to monitor receptor internalization in real time living cells using bioluminescence as a readout.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182574 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBiT1.1-C [TK/LgBiT]
-
Backbone manufacturerPromega Corporation
- Total vector size (bp) 4056
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namezinc finger FYVE-type
-
Alt nameFYVE domain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)207
-
MutationFYVE domain Q739-K806
-
Entrez GeneZFYVE16 (a.k.a. PPP1R69)
- Promoter Herpes simplex virus (HSV)
-
Tag
/ Fusion Protein
- LgBiT (Large BiT) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BgIII (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer caccgagcgaccctgcagcga
- 3′ sequencing primer attgatgagtttggacaaacc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS results confirmed LgBiT sequence is at the N-term of the insert rather than the C-term as shown in the depositor's sequence under Supplemental Documents. The depositor has confirmed that the N-term LgBiT version is the version used in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MCS-3_Endofin_LgBiT was a gift from Bradley McConnell (Addgene plasmid # 182574 ; http://n2t.net/addgene:182574 ; RRID:Addgene_182574) -
For your References section:
A NanoBiT assay to monitor membrane proteins trafficking for drug discovery and drug development. Reyes-Alcaraz A, Lucero Garcia-Rojas EY, Merlinsky EA, Seong JY, Bond RA, McConnell BK. Commun Biol. 2022 Mar 8;5(1):212. doi: 10.1038/s42003-022-03163-9. 10.1038/s42003-022-03163-9 PubMed 35260793