Skip to main content

MCS-3_Endofin_LgBiT
(Plasmid #182574)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182574 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBiT1.1-C [TK/LgBiT]
  • Backbone manufacturer
    Promega Corporation
  • Total vector size (bp) 4056
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    zinc finger FYVE-type
  • Alt name
    FYVE domain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    207
  • Mutation
    FYVE domain Q739-K806
  • Entrez Gene
    ZFYVE16 (a.k.a. PPP1R69)
  • Promoter Herpes simplex virus (HSV)
  • Tag / Fusion Protein
    • LgBiT (Large BiT) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BgIII (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer caccgagcgaccctgcagcga
  • 3′ sequencing primer attgatgagtttggacaaacc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene NGS results confirmed LgBiT sequence is at the N-term of the insert rather than the C-term as shown in the depositor's sequence under Supplemental Documents. The depositor has confirmed that the N-term LgBiT version is the version used in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MCS-3_Endofin_LgBiT was a gift from Bradley McConnell (Addgene plasmid # 182574 ; http://n2t.net/addgene:182574 ; RRID:Addgene_182574)
  • For your References section:

    A NanoBiT assay to monitor membrane proteins trafficking for drug discovery and drug development. Reyes-Alcaraz A, Lucero Garcia-Rojas EY, Merlinsky EA, Seong JY, Bond RA, McConnell BK. Commun Biol. 2022 Mar 8;5(1):212. doi: 10.1038/s42003-022-03163-9. 10.1038/s42003-022-03163-9 PubMed 35260793