pWZL hygro-hTCAB1
(Plasmid
#182593)
-
Purposeexpresses hTCAB1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182593 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepWZL
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 7257
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehTCAB1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1641
-
Entrez GeneWRAP53 (a.k.a. DKCB3, TCAB1, WDR79)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site popOMI (unknown if destroyed)
- 5′ sequencing primer GTGTGGTGGTACGTAGG
- 3′ sequencing primer ATCAGCTCACCCACACCTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWZL hygro-hTCAB1 was a gift from Agnel Sfeir (Addgene plasmid # 182593 ; http://n2t.net/addgene:182593 ; RRID:Addgene_182593) -
For your References section:
Single-Molecule Imaging of Telomerase RNA Reveals a Recruitment-Retention Model for Telomere Elongation. Laprade H, Querido E, Smith MJ, Guerit D, Crimmins H, Conomos D, Pourret E, Chartrand P, Sfeir A. Mol Cell. 2020 Jul 2;79(1):115-126.e6. doi: 10.1016/j.molcel.2020.05.005. Epub 2020 Jun 3. 10.1016/j.molcel.2020.05.005 PubMed 32497497