Skip to main content

pQCXIP-SHMY-A1Pi
(Plasmid #182648)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182648 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQCXIP
  • Backbone manufacturer
    Clontech/Takara Bio
  • Backbone size w/o insert (bp) 7181
  • Total vector size (bp) 8505
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    A1Pi
  • Alt name
    Alpha-1-antitrypsin
  • Alt name
    Alpha-1 protease inhibitor
  • Alt name
    SERPINA1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1349
  • Entrez Gene
    SERPINA1 (a.k.a. A1A, A1AT, AAT, PI, PI1, PRO2275, alpha1AT, nNIF)
  • Promoter CMV
  • Tags / Fusion Proteins
    • N-terminal ER targeting sequence of hemagglutinin (HA) (N terminal on insert)
    • His6-tag (N terminal on insert)
    • myc-tag (N terminal on insert)
    • TS site from proCCK (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer ACGCCATCCACGCTGTTTTGACCT
  • 3′ sequencing primer AAGCGGCTTCGGCCAGTAACGTTA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQCXIP-SHMY-A1Pi was a gift from Martin Spiess (Addgene plasmid # 182648 ; http://n2t.net/addgene:182648 ; RRID:Addgene_182648)
  • For your References section:

    Retrograde transport of CDMPR depends on several machineries as analyzed by sulfatable nanobodies. Buser DP, Bader G, Spiess M. Life Sci Alliance. 2022 Mar 21;5(7). pii: 5/7/e202101269. doi: 10.26508/lsa.202101269. Print 2022 Mar. 10.26508/lsa.202101269 PubMed 35314489