pORANGE_Tubb3 GFP(Y39TAG) KI
(Plasmid
#182678)
-
PurposeExpression of spCas9, gRNA targeting the end of Tubb3 gene and donor GFP(Y39TAG). Can be used for amber codon suppression and click chemistry labeling of endogenous beta-3 tubulin in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182678 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepORANGE
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTubb3-targeting gRNA and GFP(Y39TAG) donor sequence
-
Alt nameTubb3
-
gRNA/shRNA sequenceGCTGCGAGCAACTTCACTT
-
SpeciesM. musculus (mouse), R. norvegicus (rat)
-
GenBank IDNM_023279.3 NM_139254.2
-
Entrez GeneTubb3 (a.k.a. 3200002H15Rik, M(beta)3, M(beta)6)
-
Entrez GeneTubb3
- Promoter U6 and chicken beta-actin promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer aaggctgttagagagataattggaa
- 3′ sequencing primer cgggccatttaccgtaagtt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid is based on the pORANGE Tubb3-GFP KI plasmid: https://www.addgene.org/131497/. We replaced WT GFP with the GFP(Y39TAG), all other sequences were unchanged.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pORANGE_Tubb3 GFP(Y39TAG) KI was a gift from Ivana Nikić-Spiegel (Addgene plasmid # 182678 ; http://n2t.net/addgene:182678 ; RRID:Addgene_182678) -
For your References section:
Minimal genetically encoded tags for fluorescent protein labeling in living neurons. Arsic A, Hagemann C, Stajkovic N, Schubert T, Nikic-Spiegel I. Nat Commun. 2022 Jan 14;13(1):314. doi: 10.1038/s41467-022-27956-y. 10.1038/s41467-022-27956-y PubMed 35031604