TKIT NFL gRNA1 gRNA2
(Plasmid
#182681)
-
PurposeExpression of spCas9, gRNA targeting intron 3 and gRNA targeting 3'UTR of the mouse Nefl gene. Can be used for the tagging of endogenous NFL via Targeted Knock-In with Two guides (TKIT) approach.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182681 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepORANGE
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametwo Nefl-targeting gRNAs, one targets intron 3 and the other 3'UTR of the Nefl gene
-
Alt nameNefl
-
gRNA/shRNA sequenceACATATCCTTTAGGAGAGTG and GTATAATTCTGAGATGACTT
-
SpeciesM. musculus (mouse)
-
GenBank ID
-
Entrez GeneNefl (a.k.a. CMT2E, NF-L, NF68, Nfl)
- Promoter U6 and chicken beta-actin promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer NA
- 3′ sequencing primer NA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFollowing pORANGE cloning template vector (https://www.addgene.org/131471/) was used as a vector backbone.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TKIT NFL gRNA1 gRNA2 was a gift from Ivana Nikić-Spiegel (Addgene plasmid # 182681 ; http://n2t.net/addgene:182681 ; RRID:Addgene_182681) -
For your References section:
Minimal genetically encoded tags for fluorescent protein labeling in living neurons. Arsic A, Hagemann C, Stajkovic N, Schubert T, Nikic-Spiegel I. Nat Commun. 2022 Jan 14;13(1):314. doi: 10.1038/s41467-022-27956-y. 10.1038/s41467-022-27956-y PubMed 35031604