pNL3.1-Erg
(Plasmid
#182706)
-
PurposeExpress Erg enhancer in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepNL3.1[Nluc/minP]
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3151
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEnhancer of Erythroblast transformation-specific-Related Gene
-
Alt nameERG enhancer
-
Alt namechr16:95509125-95510537
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)162
-
GenBank IDNM_001302152.1
-
Entrez GeneErg (a.k.a. D030036I24Rik)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGTGCAGGTGCCAGAACATTTCTCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNL3.1-Erg was a gift from Robert Rowe (Addgene plasmid # 182706 ; http://n2t.net/addgene:182706 ; RRID:Addgene_182706) -
For your References section:
Developmental maturation of the hematopoietic system controlled by a Lin28b-let-7-Cbx2 axis. Wang D, Tanaka-Yano M, Meader E, Kinney MA, Morris V, Lummertz da Rocha E, Liu N, Liu T, Zhu Q, Orkin SH, North TE, Daley GQ, Rowe RG. Cell Rep. 2022 Apr 5;39(1):110587. doi: 10.1016/j.celrep.2022.110587. 10.1016/j.celrep.2022.110587 PubMed 35385744