p35S-hmKO1
(Plasmid
#182732)
-
PurposeTransient expression of humanized mKO1 in plant cell
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182732 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBRN169-MXMT
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehmKO1
-
Alt namehumanized monomeric Kusabira-Orange1
- Promoter CaMV 35S promoter
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GACTCTAGAGGATCCATGGTGAGCGTGATC
- 3′ sequencing primer AGCCGGGCGGCCGCTTTAGGAGTGGGCCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p35S-hmKO1 was a gift from Yutaka Kodama (Addgene plasmid # 182732 ; http://n2t.net/addgene:182732 ; RRID:Addgene_182732) -
For your References section:
A novel orange-colored bimolecular fluorescence complementation (BiFC) assay using monomeric Kusabira-Orange protein. Fujii Y, Yoshimura A, Kodama Y. Biotechniques. 2018 Apr;64(4):153-161. doi: 10.2144/btn-2017-0121. 10.2144/btn-2017-0121 PubMed 29661017