pAAV-EF1a-DIO-H2B.APEX-P2A-EGFP
(Plasmid
#182825)
-
PurposeCre-dependent expression of H2B-APEX fusion
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182825 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameH2B.APEX-P2A-EGFP
-
SpeciesSynthetic
- Promoter EF1a
-
Tag
/ Fusion Protein
- EGFP reporter (P2A)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer tccatttcaggtgtcgtgaggtac
- 3′ sequencing primer catagcgtaaaaggagcaaca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-DIO-H2B.APEX-P2A-EGFP was a gift from Yevgenia Kozorovitskiy (Addgene plasmid # 182825 ; http://n2t.net/addgene:182825 ; RRID:Addgene_182825) -
For your References section:
Cell-type and subcellular compartment-specific APEX2 proximity labeling reveals activity-dependent nuclear proteome dynamics in the striatum. Dumrongprechachan V, Salisbury RB, Soto G, Kumar M, MacDonald ML, Kozorovitskiy Y. Nat Commun. 2021 Aug 11;12(1):4855. doi: 10.1038/s41467-021-25144-y. 10.1038/s41467-021-25144-y PubMed 34381044