pGEX-2T-CBP(1-287)
              
              
                (Plasmid
                
                #182839)
              
            
            
            
          - 
            PurposeCBP(1-287) was inserted into pGEX-2T with NdeI and NsiI sites. pGEX-2T-CBP(1-287) was used in the GST pull-down assay described in our paper (Tie et al. 2012 MCB, Tie et al 2014 Development)
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182839 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepGEX-2T
- 
              Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 4900
- 
              Modifications to backboneinserted into pGEX-2T with NdeI and NsiI sites
- 
              Vector typeBacterial Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameCBP1-287
- 
                  Alt nameCREB-binding protein
- 
                    SpeciesD. melanogaster (fly)
- 
                  Insert Size (bp)861
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer CCATATGATGGCCGATCACT (Common Sequencing Primers)
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made byCBP Clone was from Sarah Smolik
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pGEX-2T-CBP(1-287) was a gift from Peter Harte (Addgene plasmid # 182839 ; http://n2t.net/addgene:182839 ; RRID:Addgene_182839)
- 
                For your References section: Trithorax monomethylates histone H3K4 and interacts directly with CBP to promote H3K27 acetylation and antagonize Polycomb silencing. Tie F, Banerjee R, Saiakhova AR, Howard B, Monteith KE, Scacheri PC, Cosgrove MS, Harte PJ. Development. 2014 Mar;141(5):1129-39. doi: 10.1242/dev.102392. 10.1242/dev.102392 PubMed 24550119
