Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEX-2T-CBP(1-287)
(Plasmid #182839)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 182839 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEX-2T
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 4900
  • Modifications to backbone
    inserted into pGEX-2T with NdeI and NsiI sites
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CBP1-287
  • Alt name
    CREB-binding protein
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    861

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer CCATATGATGGCCGATCACT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    CBP Clone was from Sarah Smolik

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-2T-CBP(1-287) was a gift from Peter Harte (Addgene plasmid # 182839 ; http://n2t.net/addgene:182839 ; RRID:Addgene_182839)
  • For your References section:

    Trithorax monomethylates histone H3K4 and interacts directly with CBP to promote H3K27 acetylation and antagonize Polycomb silencing. Tie F, Banerjee R, Saiakhova AR, Howard B, Monteith KE, Scacheri PC, Cosgrove MS, Harte PJ. Development. 2014 Mar;141(5):1129-39. doi: 10.1242/dev.102392. 10.1242/dev.102392 PubMed 24550119