pGEX-2T-TRX-C751-E3616S
(Plasmid
#182844)
-
Purposemutation E3616S (GAA/TCA), PCR product coding C-terminal residues 2976-3726 of TRX was inserted into modified pGEX-2T by Nde I-Nsi I sites. Expression in E. coli. by IPTG induction
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182844 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX-2T
- Backbone size w/o insert (bp) 4900
- Total vector size (bp) 7153
-
Modifications to backboneadd NdeI and NsiI between BamHI and EcoRI sites
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRX
-
Alt nametrithorax
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)2253
-
Entrez Genew (a.k.a. Dmel_CG2759, BACN33B1.1, CG2759, DMWHITE, DmWhite, Dmel\CG2759, EG:BACN33B1.1, W, White, c23, e(g), m(g), mini-white, mw, w(AT)[[13]])
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer CAT ATGATCCATATTCCCCAGCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The cDNA clone of TRX (LD39445) was obtained from the Drosophila Genomics Resource Center (DGRC).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-2T-TRX-C751-E3616S was a gift from Peter Harte (Addgene plasmid # 182844 ; http://n2t.net/addgene:182844 ; RRID:Addgene_182844) -
For your References section:
Trithorax monomethylates histone H3K4 and interacts directly with CBP to promote H3K27 acetylation and antagonize Polycomb silencing. Tie F, Banerjee R, Saiakhova AR, Howard B, Monteith KE, Scacheri PC, Cosgrove MS, Harte PJ. Development. 2014 Mar;141(5):1129-39. doi: 10.1242/dev.102392. 10.1242/dev.102392 PubMed 24550119