Skip to main content

pGEX-2T-TRX-C751-E3616S
(Plasmid #182844)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182844 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEX-2T
  • Backbone size w/o insert (bp) 4900
  • Total vector size (bp) 7153
  • Modifications to backbone
    add NdeI and NsiI between BamHI and EcoRI sites
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRX
  • Alt name
    trithorax
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    2253
  • Entrez Gene
    w (a.k.a. Dmel_CG2759, BACN33B1.1, CG2759, DMWHITE, DmWhite, Dmel\CG2759, EG:BACN33B1.1, W, White, c23, e(g), m(g), mini-white, mw, w(AT)[[13]])
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer CAT ATGATCCATATTCCCCAGCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The cDNA clone of TRX (LD39445) was obtained from the Drosophila Genomics Resource Center (DGRC).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-2T-TRX-C751-E3616S was a gift from Peter Harte (Addgene plasmid # 182844 ; http://n2t.net/addgene:182844 ; RRID:Addgene_182844)
  • For your References section:

    Trithorax monomethylates histone H3K4 and interacts directly with CBP to promote H3K27 acetylation and antagonize Polycomb silencing. Tie F, Banerjee R, Saiakhova AR, Howard B, Monteith KE, Scacheri PC, Cosgrove MS, Harte PJ. Development. 2014 Mar;141(5):1129-39. doi: 10.1242/dev.102392. 10.1242/dev.102392 PubMed 24550119