GFP-CBS (WT)
(Plasmid
#182923)
-
PurposeMammalian expression plasmid for human CBS
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182923 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(+)-N-eGFP
- Backbone size w/o insert (bp) 6100
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCystathionine Beta-Synthase
-
Alt nameCBS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1668
-
GenBank IDOHu26151C
-
Entrez GeneCBS (a.k.a. CBSL, HIP4)
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGGGAGGTCTATATAAGCAGAG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-CBS (WT) was a gift from Philip Eaton (Addgene plasmid # 182923 ; http://n2t.net/addgene:182923 ; RRID:Addgene_182923) -
For your References section:
SOD1 is an essential H(2)S detoxifying enzyme. Switzer CH, Kasamatsu S, Ihara H, Eaton P. Proc Natl Acad Sci U S A. 2023 Jan 17;120(3):e2205044120. doi: 10.1073/pnas.2205044120. Epub 2023 Jan 11. 10.1073/pnas.2205044120 PubMed 36630448