pCRISPRi-D2
              
              
                (Plasmid
                
                #182927)
              
            
            
            
          - 
            Purposeinducible CRISPRi plasmid with gRNA targeting to psbD gene in Synechocystis 6803
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182927 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepRSF1010
- 
              Vector typeCRISPR
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameddcpf1
- 
                    gRNA/shRNA sequencepsbD in Synechocystis 6803: gactggggcgcgtccgactg
- 
                    SpeciesSynthetic
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pCRISPRi-D2 was a gift from Himadri Pakrasi (Addgene plasmid # 182927 ; http://n2t.net/addgene:182927 ; RRID:Addgene_182927)
- 
                For your References section: A Reversibly Induced CRISPRi System Targeting Photosystem II in the Cyanobacterium Synechocystis sp. PCC 6803. Liu D, Johnson VM, Pakrasi HB. ACS Synth Biol. 2020 Jun 19;9(6):1441-1449. doi: 10.1021/acssynbio.0c00106. Epub 2020 May 21. 10.1021/acssynbio.0c00106 PubMed 32379958
 
    
 
                         
             
            