pCRISPRi-D2
(Plasmid
#182927)
-
Purposeinducible CRISPRi plasmid with gRNA targeting to psbD gene in Synechocystis 6803
-
Depositing Lab
-
Depositing OrganizationWashington University in Saint Louis
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182927 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 182927-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 182927-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepRSF1010
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameddcpf1
-
gRNA/shRNA sequencepsbD in Synechocystis 6803: gactggggcgcgtccgactg
-
SpeciesSynthetic
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 182927-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 182927-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPRi-D2 was a gift from Himadri Pakrasi (Addgene plasmid # 182927 ; http://n2t.net/addgene:182927 ; RRID:Addgene_182927) -
For your References section:
A Reversibly Induced CRISPRi System Targeting Photosystem II in the Cyanobacterium Synechocystis sp. PCC 6803. Liu D, Johnson VM, Pakrasi HB. ACS Synth Biol. 2020 Jun 19;9(6):1441-1449. doi: 10.1021/acssynbio.0c00106. Epub 2020 May 21. 10.1021/acssynbio.0c00106 PubMed 32379958
Map uploaded by the depositor.
