Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CRISPR-psbA2 point mutation
(Plasmid #182929)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 182929 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    ddcpf1
  • Species
    Francisella novicida

Gene/Insert 2

  • Gene/Insert name
    gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc

Gene/Insert 3

  • Gene/Insert name
    psbA
  • Species
    Synechococcus 7942
  • Mutation
    S264A, and silent mutation to remove PAM site

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a 105bp insertion in the backbone downstream of psbA1 compared to the depositor's provided sequence. This insertion is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CRISPR-psbA2 point mutation was a gift from Himadri Pakrasi (Addgene plasmid # 182929 ; http://n2t.net/addgene:182929 ; RRID:Addgene_182929)
  • For your References section:

    Cpf1 Is A Versatile Tool for CRISPR Genome Editing Across Diverse Species of Cyanobacteria. Ungerer J, Pakrasi HB. Sci Rep. 2016 Dec 21;6:39681. doi: 10.1038/srep39681. 10.1038/srep39681 PubMed 28000776