pIN1_GGGSx3_mScarlet
(Plasmid
#182936)
-
Purpose(Empty Backbone) C-terminal mScarlet with flexible linker (GGGGS)x3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPD95.75
-
Backbone manufacturerAndrew Fire lab
-
Modifications to backboneAn insert of 738 bp was added to generate rapid C-terminal fusions with genes-of-interest. The insert encodes 45 bp flexible linker (GlyGlyGlyGlySer)x3 followed by mScarlet.
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsNone
-
Copy numberUnknown
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCGAATGATACTAACATAACATAGAAC
- 3′ sequencing primer TAGGGATGTTGAAGAGTAATTGGACTTAGAAGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid was generated in the lab of Maureen Barr for rapid tagging of genes-of-interest with C-terminal mScarlet via a flexible linker
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIN1_GGGSx3_mScarlet was a gift from Maureen Barr (Addgene plasmid # 182936 ; http://n2t.net/addgene:182936 ; RRID:Addgene_182936) -
For your References section:
Isolation, profiling, and tracking of extracellular vesicle cargo in Caenorhabditis elegans. Nikonorova IA, Wang J, Cope AL, Tilton PE, Power KM, Walsh JD, Akella JS, Krauchunas AR, Shah P, Barr MM. Curr Biol. 2022 May 9;32(9):1924-1936.e6. doi: 10.1016/j.cub.2022.03.005. Epub 2022 Mar 24. 10.1016/j.cub.2022.03.005 PubMed 35334227